i like linux, math and video games i guess
dunno what to say
also am french
also very lazy
so lazy i’m gonna stop this bio right here
This profile is from a federated server and may be incomplete. Browse more on the original instance.
i like linux, math and video games i guess
dunno what to say
also am french
also very lazy
so lazy i’m gonna stop this bio right here
This profile is from a federated server and may be incomplete. Browse more on the original instance.
Question: is systemd-homed ready for everyday use yet?
Hi! I want to try out fedora workstation in the near future (once 39 is out) and was wondering if systemd-homed is ready for everyday use yet....
The Veluwemeer Aqueduct: Netherland's Unique Water Bridge (i.imgur.com)
The Veluwemeer Aqueduct, also known as the Drontermeeraqueduct, is a unique structure in the Netherlands that carries a canal over a large lake.This impressive water bridge spans the Veluwemeer lake, connecting the provinces of Flevoland and Gelderland
Exclusive: Google Pixel 9 processor won't be the ambitious chip we hoped for (www.androidauthority.com)
The Design is Very Human (lemmy.dbzer0.com)
having a moment here in gnome...
unholy software.. (feddit.de)
They say use whatsapp, they say use zoom (lemmy.dbzer0.com)
Firefox to become first mobile browser to support desktop extensions later this year (blog.mozilla.org)
Source: blog.mozilla.org/…/prepare-your-firefox-desktop-e…...
Why do comment counts often disagree with what I see? (lemmy.world)
FYI LibreOffice Draw allows you to open, edit and digitally sign PDF files
I see the question asked a lot in Linux groups, so I hope this bit of knowledge may help someone here.
Always at the worst times too (lemmy.ml)
“We’re always here for you" (reddthat.com)
For context: One of the rules in that community is that you aren’t allowed to post anything related to suicide. In a mental health community.
Anyone who downloaded the GOG Baldur's Gate 3 release from 1337x, scan with Malwarebytes asap! (kbin.social)
Originally posted over on /r/piracy (https://www.reddit.com/r/Piracy/comments/15itrip/1337x_admins_allowing_bg3_torrent_with_bitcoin/)...
Every time i have to use windows again my IQ slips a point or two (lemmy.one)
dreaming (lemmy.world)
AACGTCATAGCCTGATTACCAGTAGGTACTAG (lemmy.ml)
An image of Mr Krabs saying “Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG”
My sister called this the plant that smells like bubble gum as a kid (feddit.de)
The state of Playstore (lemmy.dbzer0.com)
Ads upon ads upon ads
Wise one (lemmy.world)
POST @joyoftech
Is jellyfish vegan?
They don’t have a brain really and kinda just float there. Do they even feel pain?
EU wants over 70s to prove they can still drive every five years (www.brusselstimes.com)
The European Union wants elderly people (70+) to undergo medical tests from now on to prove that they are still capable of driving a car every five years. However, the proposal has been met with a lot of criticism.
How to create a sandbox folder, restricting write access to all files contained in it to that folder itself?
Hello! Let’s say I have an executable file, but I’m unsure of the source, and may contain bugs/errors/malwares/bad things that can mess up my machine. I want to execute it anyway, but I want to make sure that it does not mess things up. Is it possible to create a “sandbox” folder, place the executable inside it, and then...
YSK: Your Lemmy activities (e.g. downvotes) are far from private (i.imgur.com)
Edit: obligatory explanation (thanks mods for squaring me away)…...
Sony blocked Roblox on PlayStation due to concerns it could "potentially exploit" young audience | Eurogamer (www.eurogamer.net)
Side effects of nitric oxide?
Hi. I just started buteyko method, and it’s supposed to relax you and release nitric oxide when you do it. I did a session earlier, and I started seeing visuals/swirling of colors in my eyes. I’m pretty sure it was the nitric oxide being released. Are there any major side effects to nitric oxide? Could I get super high if my...