[Homemade] Burgers (lemmy.ca)
Yesterday’s dinner simple burgers with salad, ground steak, cheese and onion (I like cheese btw)
From Mental Outlaw video (discuss.tchncs.de)
ich🔥🧱iel (lemmy.world) German
Links und rechts im Bild ist jeweils ein Hund....
Honk. Honk? Honk! *scared player noises* (ttrpg.network)
ich🚽iel (lemmy.world) German
Roundmeal rule (lemmy.blahaj.zone)
ich_iel (lemmy.world) German
ich🎙️iel (feddit.de) German
parallel ruleverses (files.catbox.moe)
and they lived happily ever after (lemmy.world)
Humor Rule (lemmy.ml)
tfw you say the n word 15 times and are still oppressed, exploited and doomed
I'm running low on memes (lemmy.world)
Have mercy on me (lemmy.world)
Recently had roof replaced. Is this normal? (lemmy.world)
There are 3-4 spots like this. Want to make sure to discuss with contractor if I should prior to making last payment.
Reposting my old stuff #10: Sprechen Sie German? (ttrpg.network)
[OC] You don't need to conform to be beautiful. (lemmy.ca)
Trash can cat (lemmy.world)
Alert (lemmy.world)
What's wrong with me?!?! (lemmy.ml)
Cosy guest room complete with tarp bed! (feddit.uk)
teeth rule (media.discordapp.net)
Based Romania on r/place (Fuck Spez) (media.kbin.social)
AACGTCATAGCCTGATTACCAGTAGGTACTAG (lemmy.ml)
An image of Mr Krabs saying “Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG”